Skip to main content

Table 1 Primers used for PCR

From: Expression of leukemia inhibitory factor (LIF) and its receptor gp190 in human liver and in cultured human liver myofibroblasts. Cloning of new isoforms of LIF mRNA

Primer Sequence (*): 5'> 3' Orientation Ref.
hLIF-D ATAATGAAGGTCTTGGCGGCAG Forward  
HLIF-D3 AAACTGCAGGCATCTGAGGTTTCCTCCAA Forward  
hLIF-M2 CTGGAAGCGTGTGGTCTG Forward  
HLIF-M3 AAACTGCAGCTGGAAGCGTGTGGTCTG Forward  
hLIF-M5 TAGAATTCTGGAAGCGTGTGGTG Forward [3]
hLIF-T5 ATGAATTCTGTCACCTTTCACTTTCCT Forward [3]
hLIF-2N AATAAAGAGGGCATTGGCAC Reverse  
hLIF-3N TTCTGGTCCCGGGTGATGTT Reverse [3]
HLIF-N4 GCTCTAGAGAAGGCCTGGGCCAACAC Reverse  
  1. (*) Bases in italics refer to restriction sites.