Skip to main content

Table 2 Primer sequences of the studied genes.

From: Characterization of chronic HCV infection-induced apoptosis

Gene Name Primer Sequence Fragment Length
β-actin 5'-ACA CTG TGC CCA ACG AGG-3'
5'-AGG GGC CGG TCA T AC T-3
621 bp
Fas 5'-GCAACACCAAGTGCAAAGAGG-3'
5'-GTCACTAGTAATGTCCTTGAGG-3'
265 bp
FasL 5'- ATGTTTCAGCTCTTCCACCTACAGA-3'
5'-CCAGAGAGAGCTCAGATACGTTGAC-3'
255 bp
Bak 5'-TGATACCTGTGCTTTATCCC -3'
5'- AAACCAGCATCTCTCTAAAC-3'
250 bp
Bcl-2 5' GCAGATCCAGGTGATTCTCG 3'
5' ATCGATGCCAATGACAGCCA 3'
234 bp
Bcl-XL 5'-CCCGGTGCTGCAGCATGTCCT -3'
5'-TCCCCTCGAGGATTTCGACAG -3'
521 bp