Skip to main content

Table 2 Primers.

From: Response of sinusoidal mouse liver cells to choline-deficient ethionine-supplemented diet

  Upper primer Lower primer Accession number
Adipophilin ccctgtctaccaagctctgc cgatgcttctcttccactcc NM_007408
L-Pk ttctgtctcgctaccgacct cctgtcaccacaatcaccag NM_013631
GFAP cacgaacgagtccctagagc atggtgatgcggttttcttc NM_012773
Vimentin atgcttctctggcacgtctt agccacgctttcatactgct NM_011701
Nestin gatcgctcagatcctggaag gagaaggatgttgggctgag NM_016701
PECAM1(CD31) tgcaggagtccttctccact acggtttgattccactttgc NM_008816
CD14 ctgatctcagccctctgtcc gcttcagcccagtgaaagac NM_009841
Cyclophilin aagactgaatggctggatgg ttacaggacattgcgagcag NM_008907
E-cadherin tgctgattctgatcctgctg ggagccacatcatttcgagt NM_009864
N-cadherin ctgggacgtatgtgatgacg ggattgccttccatgtctgt NM_007664
LI-cadherin cctgaagcccatgacattct ccgctcttgtttctctgtcc NM_019753
M-Pk-pair 1 gcatcatgctgtctggagaa gtaaggatgccgtgctgaat NM_011099
M-Pk pair 3 tcgaggaactccgccgcctg gtaaggatgccgtgctgaat NM_011099
M-Pk pair 4 cagacctc atggaggcca tgg gtaag gatgccgtgctgaat Heart cDNA and NM_011099
M-Pk-pair 5 tgtttagcagcagctttg ctatcattgccgtgactcga Heart cDNA and NM_011099
M-Pk-pair 6 caccgtctgctgtttgaaga ctatcattgccgtgactcga Heart cDNA and NM_011099