Skip to main content

Table 1 Primer pair sequences, accession numbers, amplicon size and annealing temperature conditions for genes of interest used for real-time PCR.

From: Interactions Between Estrogen- and Ah-Receptor Signalling Pathways in Primary Culture of Salmon Hepatocytes Exposed to Nonylphenol and 3,3',4,4'-Tetrachlorobiphenyl (Congener 77)

Target Gene Primer sequence* Amplicon size (nucleotides) Annealing temperature (°C) GenBank accession number
  Forward Reverse    
ERα TCCAGGAGCTGTCTCTCCAT GATCTCAGCCATACCCTCCA 173 55 DQ009007
ERβ GAGCATCCAAGGTCACAATG CACTTTGTCATGCCCACTTC 126 59 AY508959
Vtg AAGCCACCTCCAATGTCATC GGGAGTCTGTCCCAAGACAA 391 57 DY802177
Zr-protein TGACGAAGGTCCTCAGGG AGGGTTTGGGGTTGTGGT 113 55 AF407574
Vigilin GGGATACGCACAGACACCTT CCCAGATTCCACAGACACCT 86 60 DY802195
AhRα AGGGGCGTCTGAAGTTCC GTGAACAGGCCCAACCTG 82 60 AY219864
AhRβ GACCCCCAGGACCAGAGT GTTGTCCTGGATGACGGC 96 65 AY219865
AhRR TTCCTCCAGGGACAGAAGAA ATGGAGGGCAGCAGAAGAG 98 60 DQ372978
Arnt AGAGCAATCCCAGGGTCC TGGGAGGGTGATTGAGGA 107 60 DQ367887
CYP1A1 GAGTTTGGGCAGGTGGTG TGGTGCGGTTTGGTAGGT 76 60 AF364076
UDPGT ATAAGGACCGTCCCATCGAG ATCCAGTTGAGGTCGTGAGC 113 55 DY802180
Proteasome TCTTTGACCAGGTTGCACAG CATACAAAGCTGGTGGCTCA 134 60 DY802110