Skip to main content

Table 2 Primers and probes used in real-time PCR.

From: Sensitivity to endothelin-1 is decreased in isolated livers of endothelial constitutive nitric oxide synthase knockout mice

Gene Forward primer Probe Reverse primer
PreproET1 tggtggaaggaaggaaactacg aggttggaggccatcagcaacagc ttgcaacacgaaaagatgcc
ETA tgacctccccatcaacgtg ttaagctcttggcaggacgctggc tccaaaatcattgtggtcgaaa
ETB cgtgttcgtgctaggcatca cgggaactccacgctgctaagaatcat ttgcgcatgcacttgttctt
GAPDH actggcatggccttccg ttcctacccccaatgtgtccgtcgt caggcggcacgtcagatc
ecNOS ctgcaaaccgtgcagagaatt tggcaacagagggcggcatg caccggcttcatccagct
iNOS ggcagcctgtgagacctttg tgtccgaagcaaacatcacattcagatcc ttgcattggaagtgaagcgtt
Adrenomedullin cagggttcccgcagca atgccgcttcgggacctgca tagatctggtgggccaatttct